معرفی و شناسایی Cladosporium uredinicola بعنوان یکی از قارچ های اندوفیت چای (Camellia sinensis)
کد مقاله : 1607-23IPPC
نویسندگان
سیاهکل- جنب فرمانداری- خیابان ارشاد
چکیده
اندوفیتهای قارچی درقسمتی از زندگی خود داخل بافتهای گیاه زندگی میکنند بدون اینکه به میزبان خود خسارت بزنند. در این بررسی یک ایزوله اندوفیت از برگهای یکساله و بدون علائم چای از باغی واقع در شهرستان سیاهکل از توابع استان گیلان جداسازی گردید. پس از جمع آوری، به منظور ضدعفونی سطحی، نمونههای تهیه شده به مدت نیم ساعت در داخل آب با مایع ظرفشویی قرار داده شدند و پس از آن با آب شیر شستشو داده شد. بعد در اتانول 75 درصد به مدت 30 ثانیه غوطه ور گردیده، پس از 3 بار شستشو با آب مقطر استریل به مدت 3 دقیقه در محلول هیپوکلریت سدیم 5/1 درصد قرار داده شدند. پس از آن مجددا 5 بار با آب مقطر استریل شستشو گردیده و با کاغذ صافی استریل آبگیری شدند. سپس قسمت میانی آنها به صورت یک مربع برش داده شد و روی محیط کشت PDA کشت گردید و در دمای 25 درجه سانتیگراد به مدت ده روز نگهداری شد تا قارچ رشد نماید. بر اساس خصوصیات ریخت شناسی این ایزوله روی محیط کشت PDA تولید میسلیوم زیتونی رنگ براق فشرده نمود. در بررسی میکروسکوپی کنیدیوفورها بلند و تیره و به ابعاد 3/2-1/2 × 90-87 میکرومتر بودند. کنیدی ها تک سلولی، تیره به اشکال مختلف سیلندری، نامنظم و تا حدودی لیمویی شکل دیده شدند که معمولا تشکیل زنجیره های منشعب به ابعاد 8/7-1/2 × 5/3-2 میکرومتر را دادند. در بررسی مولکولی DNA ژنومی قارچ مورد بررسی با استفاده از روش CTAB با اندکی تغییر جداسازی گردید بدین منظور با استفاده از جفت پرایمر ITS4 (TCCTCCGCTTATTGATATGC) وITS1 (TCCGTAGGTGAACCTGCGG)، منطقهITS گونه قارچی در PCR تکثیر گردید و پس از تعیین توالی محصول PCR توالی مشخص شده در BLAST مورد ارزیابی و شناسایی قرار گرفت. براساس ارزیابی ناحیه ITS دی.ان.ای ریبوزومی این ایزوله با شباهت 99% بعنوان Cladosporium uredinicola شناسایی گردید و accession number آن در بانک ژن NCBI نیز با کد KY488352 شناسایی گردید.
کلیدواژه ها
موضوعات
Title
Identfiication and introduction of Cladosporium uredinicola as an endophytic fungus from tea plant (Camellia sinensis)
Authors
seyyedeh leila akbari kiarood
Abstract
Endophytic fungi are organisms inhabiting the living plant organs at some time during their life, without causing apparent harm to the host. In this research one isolate of endophytic fungi was separated from one-year-old and asymptomatic leaves of tea plant from tea-garden which was located in siyahkal city from Gilan province. For fungal isolation, leaf samples were immersed in water with saturated detergent for 30 min, then washed with tap water. Leaf samples soaked with %75 ethanol for 30 sec and rinsed three times with sterile distilled water, finally after disinfecting with %1.5 sodium hypochlorite for 3 min and rinsing with sterile distilled water 5 times then the samples dried on sterile filter paper. After these stages a leaf square was cut from each sample with sterile scalpel and plated on PDA medium then incubated at 25°C for ten days until observation of the fungal growth. According to morphological and cultural characteristics this isolate formed compacted shiny olivaceous mycelium on PDA. Conidiophores were tall and dark and their size were 87-90 × 2.1-2.3 µm. Conidia were dark, 1-celled and variable in shape from cylindrical to irregular and some typically lemon-shaped usually in branched chains, 2-3.5 × 2.1-7.8 µm. In molecular assessment genomic DNA of the endophytic fungi was extracted using CTAB method with some amendation. Amplification of ITS-rDNA, was done in a thermocycler using primer pair ITS1(TCCGTAGGTGAACCTGCGG) and ITS4(CCTCCGCTTATTGATATGC). Then for identification, PCR products sequencing was evaluated in BLAST. With analysis of rDNA internal transcribed spacer (ITS) sequence this isolate was further confirmed Cladosporium uredinicola with 99% similarity and its NCBI, Gene Bank accession number was KY488352.
Keywords
Asymptomatic leaves, Endophytic fungi, Guilan Province