شناسایی یک گونه از Xylaria sp. بعنوان قارچ اندوفیت روی پرتقال تامسون ناول
کد مقاله : 1608-23IPPC
نویسندگان
1سیاهکل- جنب فرمانداری- خیابان ارشاد
2مازندران-رامسر-بلوار شهید مطهری
3دانشکده تولید گیاهی، گروه گیاهپزشکی، دانشگاه علوم کشاورزی و منابع طبیعی گرگان
چکیده
قارچهای اندوفیت از عوامل مهم و ناشناختهای هستند که در شرایط مختلف محیطی ناشی از تنش خشکی، سرما و آسیبهای فیزیولوژیکی به واسطه تشکیل متابولیتهای ثانویه و اختصاصی نقش مهمی در بقای درختان مرکبات دارند. در این بررسی یک ایزوله اندوفیت از برگ-های سالم درخت پرتقال تامسون ناول واقع در شهرستان لاهیجان از استان گیلان جداسازی گردید. ابتدا پس از شستشو با جریان آب ملایم قسمت میانی برگها به موازات رگبرگ اصلی برش داده شد و به منظور ضدعفونی سطحی نمونهها به ترتیب در اتانول 96 درصد به مدت یک دقیقه ، هیپوکلرید سدیم 5/3 درصد به مدت 5 دقیقه و مجددا در اتانول 96 درصد به مدت 30 ثانیه قرار داده شدند و پس از 2 بار شستشو با آب مقطر استریل و آبگیری روی کاغذ صافی به محیط کشت PDA منتقل گردیدند. تشتکهای پتری در دمای 25 درجه سانتیگراد به مدت ده روز نگهداری شدند تا قارچ رشد نماید. بر اساس خصوصیات ریخت شناسی این جدایه روی محیط کشت PDA تولید پرگنه سفید رنگ و براق نمود که پس از 10-7 روز نقاط سیاه رنگی روی آن دیده شد و استرومای شیری رنگی در این نقاط تشکیل گردید که دارای 2 تا 3 میلی متر قطر در پایه و 7/2-2/1 سانتی متر طول بودند. در بررسی مولکولی، DNA ژنومی گونه قارچ مورد بررسی با استفاده از روش Fast Prep استخراج گردید و منطقه ITS آن با بکارگیری جفت پرایمرهایITS4 (TCCTCCGCTTATTGATATGC) و ITS1 (TCCGTAGGTGAACCTGCGG)، در PCR تکثیر گردید. و پس از تعیین توالی محصول PCR، توالی مشخص شده در BLAST مورد ارزیابی و شناسایی قرار گرفت. براساس ارزیابی ناحیه ITS دی.ان.ای ریبوزومی این ایزوله با گونهXylaria venosula 99% شباهت داشت و accession number آن در بانک ژن NCBI نیز MF919405 بود.
کلیدواژه ها
موضوعات
Title
Identification of one species of Xylaria sp. as endophytic fungi on Thomson Novel sweet Orange
Authors
seyyedeh leila akbari kiarood, Morteza Golmohammadi, saeid nasrollanejad
Abstract
Citrus endophyte fungi are unknown organism that living within tissues of fruit trees in various environment due to the drought stress, frost damage and physiological effects. They have special role in survival of these trees by producing specific secondry metabolites. In this research one isolate of endophytic fungi was separated from healthy leaves of orange tree (Citrus sinensis) Tompson cultivar in Lahijan city from Guilan provience. For fungal isolation samples were washed with tap water and then their inner side were cut along the main vein. For surface sterilization samples were soaked in 96% ethanol for 1min, 3.5% sodium hypochlorite for 5min and 96% ethanol for 30 sec respectively. Then rinsed with sterile distilled water twice and dried on sterile filter paper. Finally those samples were cultured on PDA medium and incubated at 25°C for ten days until observation of the fungal growth. According to morphological characteristics of this isolate formed shiny white mycelium on PDA. After 7-10 days black spots observed on colonies that became milky color stroma with
2-3mm thickness at base and 1.2-2.7 cm length was rised from each one. In molecular assessment genomic DNA of the endophytic fungi was extracted using Fast Prep method. Amplification of ITS-rDNA, was done in a thermocycler using primer pair ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (CCTCCGCTTATTGATATGC). Then for identification, PCR products sequencing was evaluated in BLAST. With analysis of rDNA internal transcribed spacer (ITS) sequence this isolate was further confirmed Xylaria venosula with 99% similarity and its NCBI, Gen Bank accession number was MF919405.
2-3mm thickness at base and 1.2-2.7 cm length was rised from each one. In molecular assessment genomic DNA of the endophytic fungi was extracted using Fast Prep method. Amplification of ITS-rDNA, was done in a thermocycler using primer pair ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (CCTCCGCTTATTGATATGC). Then for identification, PCR products sequencing was evaluated in BLAST. With analysis of rDNA internal transcribed spacer (ITS) sequence this isolate was further confirmed Xylaria venosula with 99% similarity and its NCBI, Gen Bank accession number was MF919405.
Keywords
Xylaria venosula, Citrus endophyte, healthy leaves