During recent years, grapevine decline has been distributed in several provinces of Iran as well as several counties of Zanjan province. In order to identify the fungi associated with decline of grape trees from vineyards in Zanjan province, samples of shoots were taken from symptomatic grapevine plants during 2015 and 2016. After culturing of plant samples on the general media of PDA and MEA containing Tetracycline antibiotic, a total of 82 fungal isolates were obtained. Isolates were identified based on morphological characters using reliable morphological keys. For adequate and final species identification of some isolates, molecular data based on ITS1-5.8S-ITS2 sequence amplified using primer pair of ITS4 (5TCCTCCGCTTATTGATATGC3) and ITS1 (5TCCGTAGGTGAACCTGCGG3) were also analyzed. The amplicons sequences were edited in Finch TV and then were compared with sequences from NCBI. In this study, 16 fungal genera and species were identified: Botryosphaeria dothidea, Cytospora chrysosperma, Acremonium sclerotigenum, Alternaria sp., Candida sp., Gilmaniella sp., Gliocladium sp., Rhizoctonia sp., Clonostachys rasea ,Epicoccum nigrum, Coniochaeta sp., Fusarium sp., Cylindrocarpon sp., Botrytis cinerea, Biscogniauxia mediterrane and Chaetomium sp. Among the fungal species and genera, C. chrysosperma, Fusarium sp. and Chaetomium sp. had the most frequency. Among the isolates, pathogenic fungal species associated with decline such as B. dothidea, C. chrysosperma, A. sclerotigenum and Cylindrocarpon sp. were observed. Before this study, there is no report of the occurrence of B. mediterranea, C. rosea, Coniochaeta sp. and Gilmaniella sp. on grapevine in Iran. Also this is the first report of Gilmaniella sp. on grapevine in the world.